Select Page

Cloning from cDNA: human SLUG, VSP24 and NKCC2

PCR Success Story #4

Project Description

Cloning from cDNA: 3 Genes to Amplify by High-Fidelity PCR

Our first ”cloning” challenge (we actually only do the PCR part) consisted in optimizing the PCR protocols for the High-Fidelity Cloning from cDNA. Human SLUG (NM_003068), VSP24 (NM_016079.3) and NKCC2 (NM_000338.2) needed to be amplified from human cDNA provided by a customer at the CR-CHUM in Montréal. Cloning primers were designed by the customer. The customer mentionned that other DNA polymerases failed at amplifying their desired full-lenght genes, The researcher provided us with PCR primers and 2 cDNAs. Please find bellow a resume of what we have accomplished using Transgen Biotech’s High-Fidelity DNA Polymerases.

Primer sequences to achieve Cloning from cDNA were as follows.

Letters in bold represent the gene-specific parts of each primer; GC% and Tm are indicated for the gene-specific regions:

NKCC2 (3299 bp)

  • Forward: TTTCTAGAATGTCACTGAACAACTCTTC (40% GC; Tm = 49°C)
  • Reverse: CACCCGGGGTTAAGAGTAAAATGTCAAGAC (29% GC; Tm = 44°C)

SLUG (807 bp)

  • Forward: TTGGATCCATGCCGCGCTCCTTCCTGGTC (67% GC; Tm = 66°C)
  • Reverse: TTCCCGGGTCAGTGTGCTACACAGCAGCC (57% GC; Tm = 61°C)

VSP24 (668 bp)

  • Forward: ATGGGGCTGTTTGGAAAGACCCA (52% GC; Tm = 62°C)
  • TTCCCGGGCTAGCTGCGGAGTGTGGCCAGCC (70% GC; Tm = 69°C)

Project Details

Client: CR-CHUM
Date: April 14th, 2016
Type of experiment: High-Fidelity amplification and subsequent Cloning from cDNA
DNA Polymerases: TransStart FastPfu and FastPfu FLY

Competitors: None

Cloning from cDNA : PCR amplification of SLUG and VSP24

SLUG and VSP24 on our First Attempt

Even if overall primer melting temperatures (Tm) were from 61 to 69 °C, we attempted PCR amplfication of human SLUG and VSP24 from human cDNA in the presence or not of 1X PCR Stimulant. Amplification of SLUG was perfect under the conditions used whereas and increase of 2-3 °C for the annealing temperature was recommended to the researcher. Since TransStart FastPfu FLY ‘s fidelity is twice as better than FastPfu, we recommended to the researcher to use the former Ultra-HiFi DNA Polymerase.

NKCC2 on our First Attempt

The PCR amplfication of human NKCC2 from human cDNA was pretty straighforward and was perfectly successful on our first attempt. Since TransStart FastPfu FLY ‘s fidelity is twice as better than FastPfu, we recommended to the researcher to use FLY in their own attempt to perform the Cloning from cDNA in their lab.

Cloning from cDNA PCR amplification of NKCC2

PCR reaction setup:

  • H2O : 11.2 ul
  • 5x buffer : 4 ul
  • dNTPs (2.5mM): 1.6 ul (0.2 mM final)
  • F1 (4 uM): 1 ul (200 nM final)
  • F2 (4 uM): 1 ul
  • cDNA : 0.8 ul human cDNA
  • Pol (2.5 u/ul) : 0.4 ul

PCR cycling :

  1. Denaturation: 120s at 94 °C
  2. 35 x
    1. Denaturation: 15s at 94 °C
    2. Annealing: 20s at 62 °C for SLUG; 65 °C for VSP24; 47 °C for NKCC2
    3. Extension: 15s at 72 °C for SLUG and VSP24; 50s for NKCC2
  3. Final extension: 120s at 72 °C