PCR Success Story #17: High-Fidelity PCR Amplification of repetitive sequences and PCR Overlap Assembly of 3 Fragments
PCR Success Story #17Project Description
High-Fidelity PCR Amplification of repetitive sequences and PCR Overlap Assembly of 3 Fragments
This project originated from a customer referral who learned about our problem-solving abilities. The researcher’s lab is located at the Centre de Recherche du Centre Hospitalier de l’Université Laval (CR-CHUL) in Québec city. They challenged us to amplify DNA sequences from confidential genomic DNA and from DNA plasmids containing other sequences of interest. Their goal was to assemble these 3 fragments by PCR overlap extension.
They tried to perform this using Phusion DNA Polymerase but were unsuccessful in the steps detailed below:
- The first challenge was to obtain specific bands by high-fidelity PCR.
- Then, assemble everything together by PCR overlap and extension.
Note: we had to redesign some of their primers because one of them had 2 binding sites, thus the PCR amplification could not be specific.
Project Details
Client: Université Laval
Date: August 4th, 2016
Type of experiment: High-Fidelity PCR and PCR overlap and extension
DNA Polymerase: TransStart FastPfu (High-Fidelity) DNA Polymerase & KD Plus
Competitor: Phusion® High-Fidelity DNA Polymerase (NEB version)
Phusion® is a trademark of ThermoFisher Scientific
Desired DNA Fragment Assembly Design
Problem: primer C has 2 binding sites…
Original primer C :
TTCTCCTTCCCCTCTCTCTC
5′ end of MIDDLE fragment (primer C binding sites in bold and underlined):
CATCCCGTTCTCCTTCCCCTCTCTCTCCTCTCTCCTCTCTCCAGGAGTTCTCTCATCTCCTTCCCCTCTCTCTCCTCTCTCCTCTCTCCAGAG
A second binding site was identified for primer C containing a single mismatch in its extreme 5′ (A). Therefore we redesigned this primer to: GTTCTCCTTCCCCTCTCTCTCCTCTCTCCTCTCTCCAGGAG
PCR amplification of AB, CD and EF fragments
The AB fragment was amplified using TransStart KD Plus (Ultra-HiFi) DNA Polymerase.
CD and EF fragment were amplified by PCR using TransStart FastPfu (High-Fielity) DNA Polymerase.
The arrows point to the specific amplicons that were then extracted ad purified using the Favorprep GEL/PCR Purification Kit.
Successful PCR Overlap Assembly with FastPfu
SUCCESS !
-
2×TransStart FastPfu FLY (Ultra-HiFi) PCR SuperMix – AS231
$500.00 CAD -
2x TransStart FastPfu PCR SuperMix (-dye) – AS221
$88.00 – $375.00 CAD -
5x FastPfu FLY Buffer (with Mg2+) – GK221
$33.00 CAD -
Sale!
CUSTOM KIT – EasyTaq + High-Fidelity DNA Polymerases
From: $330.40 CAD -
TransStart FastPfu FLY DNA Polymerase (Ultra High-Fidelity) – AP231
$258.00 – $1,321.00 CAD -
TransStart FastPfu High-Fidelity DNA Polymerase – AP221
$113.00 – $1,023.00 CAD