1-877-661-4711 info@civicbio.com
Select Page

High-Fidelity PCR Amplification of Pseudomonas aeruginosa murC and murE

PCR Success Story #14

Project Description

High-Fidelity PCR Amplification of Pseudomonas aeruginosa murC and murE

This cloning project originated from the lab of a new researcher located at the main campus of Université de Montréal. It consisted in optimization of PCR conditions for the amplification of murC and murE from Pseudomonas aeruginosa. Cloning primers were designed by the customer in order to perform High-Fidelity PCR Amplification from Pseudomonas gDNA.

Pseudomonas aeruginosa genomic DNA was extracted from 1 colony with TransDirect Animal Tissue AD1, AD2, AD3 buffer set but was not purified.

Primer sequences were as follows. Letters in bold represent the gene-specific parts of each primer; GC% and Tm are indicated for the gene-specific regions:3

murC (1439 bp)

  • Forward: tgacaagctttcagtgatggtgatggtgatggtgatggtgatgagagccaccgccacctgcgcccttccctcc (annealed bases: 73% GC; Tm = 57 °C)
  • Reverse: gtcacatatggttaaagaaccgaatggcgtca (annealed bases: 48% GC; Tm = 60.5 °C)

murE (1461 bp)

  • Forward: tgacaagctttcagtgatggtgatggtgatggtgatggtgatgagagagccaccgccaccagcatgcggcacctcc (annealed bases: 69% GC; Tm = 60.5 °C)
  • Reverse: gtcacatatgcctatgagcctgaaccaactg (annealed bases: 50% GC; Tm = 60.5 °C)

 

Project Details

Client: Université de Montréal
Date: June 10th, 2016
Type of experiment: High-Fidelity amplification from Pseudomonas aeruginosa gDNA
DNA Polymerases: TransStart FastPfu and FastPfu FLY

Competitors: None

PCR murC FastPfu with PCR Stimulant gradient-Good

PCR Amplification of murC using FastPfu

The murC gene has an overall GC content of 67% GC with some segments reaching 75% GC.

TransStart FastPfu was used to amplify murC from Pseudomonas aeruginosa genomic DNA. As illustrated here, successful amplification necessitated the addition of PCR Stimulant. 1.5 ul of the PCR reaction was migrated on a 1% agarose gel in TAE 1x.

Stimulant?

PCR setup for High-Fidelity PCR:

  • H2O : to 50 ul
  • 5x buffer : 10 ul
  • PCR Stimulant (5x): 5, 10 or 15 ul
  • dNTPs (2.5mM): 4 ul (0.2 mM final)
  • F1 (10 uM): 2 ul (200 nM final)
  • F2 (10 uM): 2 ul
  • cDNA : 5 ul of P.aeruginosa colony gDNA extrcted with TransDirect Animal Tissue Buffer Set
  • FastPfu (2.5 u/ul) : 1 ul

PCR cycling for High-Fidelity PCR

  1. Denaturation: 60s at 98 °C
  2. 35 x
    1. Denaturation: 15s at 98 °C
    2. Annealing: 35s at 54 °C
    3. Extension: 40s at 72 °C
  3. Final extension: 300s at 72 °C

High-Fidelity PCR Amplification of murE using FastPfu and FastPfu FLY

The murE gene has an overall GC content of 69% GC with some segments reaching 80% GC.

TransStart FastPfu was used to perform High-Fidelity PCR and amplify murE from Pseudomonas aeruginosa genomic DNA. As illustrated here, successful amplification necessitated the addition of PCR Stimulant to 1x fnal concentration. 1ul of the PCR reaction was migrated on a 1% agarose gel in TAE 1x.

FLY !
PCR murE FastPfu and FLY with PCR Stimulant

PCR reaction setup:

  • H2O : to 50 ul
  • 5x buffer : 10 ul
  • PCR Stimulant (5x): 10 ul
  • dNTPs (2.5mM): 4 ul (0.2 mM final)
  • F1 (10 uM): 2 ul (200 nM final)
  • F2 (10 uM): 2 ul
  • cDNA : 5 ul of P.aeruginosa colony gDNA extrcted with TransDirect Animal Tissue Buffer Set
  • FastPfu (2.5 u/ul) : 1 ul

PCR cycling :

  1. Denaturation: 60s at 98 °C
  2. 35 x
    1. Denaturation: 15s at 98 °C
    2. Annealing: 35s at 52 °C
    3. Extension: 40s at 72 °C
  3. Final extension: 300s at 72 °C

Problems with high-fidelity PCR?

Contact us and use our FREE PCR optimization service