Select Page

High-Fidelity and Specific PCR from human gDNA

PCR Success Story #9

Project Description

Specific PCR with High-Fidelity DNA Polymerases

This project was quite important to solve. We met with a researcher located at the Centre de Recherche du CHU Ste-Justine who had the following problem. The lab extracts and purifies genomic DNA from patients blood and need to amplify human genes with high-fidelity and high specificity. Then, they sequence the PCR product in order to find rare mutations. Their freezer was loaded with both NEB and Thermo’s Phusion® High-Fidelity DNA Polymerase yet, PCR amplification results were poor. They contained many wrong-sized bands which affected greatly the subsequent DNA sequencing results. Achieving Specific PCR amplification was a must for them. The researcher provided us with their primers for hSSPO and their purified human gDNA. Please find below first-attempt results obtained using Transgen Biotech’s TransStart FastPfu FLY (Ultra-HiFi) DNA polymerase and other DNA polymerases.

hSSPO forward primer: TGATCTGTCTTCCTGCCACA

hSSPO reverse primer: CCTTGACCAGGTCCATGACT

Phusion® is a trademark of ThermoFisher Scientific.

 

Project Details

Client: CR-CHU Ste-Justine
Date: May 25th, 2016
Type of experiment: Human gDNA high-fidelity amplification by PCR
DNA Polymerase: TransStart FastPfu FLY (Ultra-HiFi) DNA Polymerase.

Competitor: Thermo Phusion® HotStart II High-Fidelity DNA Polymerase

hSSPO Specific PCR from gDNA with FastPfu FLY

Specific PCR amplification of hSSPO from gDNA with FastPfu FLY

Amplification of a segment of hSSPO from purifed gDNA DNA samples from two researchers located in two different institutes. Human MC2R was also amplified as a control using TransStart FastPfu High-Fidelity DNA Polymerase. Although the results for hSSPO using FastPfu were almost tolerable, TransStart FastPfu FLY (Ultra-HiFi) DNA polymerase amplified hSSPO perfectly in contrast to Phusion® HotStart II High-Fidelity DNA Polymerase. The researcher also performed the same experiment in his lab using sample-size of FastPfu FLY and also achieved perfect amplification of hSSPO. Even if the researcher’s freezer was loaded with more than 1000$ worth of the Phusion®, we received an order for FastPfu FLY on the next day :-). In addition to getting better future results, the researcher now  also benefits from a DNA Polymerase offering twice the fidelity than Phusion®.

PCR reaction setup:

  • H2O : 12.2 ul
  • 10x buffer : 4 ul
  • dNTPs (2.5 mM): 1.6 ul (0.2 mM final)
  • Forward primer (25 uM): 0.16 ul (200 nM final)
  • Reverse primer (25 uM) : 0.16 ul (200 nM final)
  • gDNA 10 ng/ul : 1 ul
  • Polymerase (2.5 u/ul) : 0.4 ul

PCR cycling :

  1. Denaturation: 60s at 94 °C
  2. 35 x
    1. Denaturation: 15s at 94 °C
    2. Annealing: 20s at 57 °C
    3. Extension: 10s at 72 °C
  3. Final extension: 60s at 72 °C

Want perfect PCR too?

Put us in charge of optimizing PCR conditions for you. It’s FREE !