Select Page

STR analysis and Prenatal Sex Genotyping by PCR of Fetal Cell-Free DNA purified from 18 ul of a 10-week pregnant woman's blood

PCR Success Story #24
Last Modified on : May 25, 2019

This time it’s personal

Ten weeks ago, my girlfriend got pregnant… or maybe I should say that I got her pregnant. Having easy access to a lab and many reagents, I wanted to  investigate wether I could determine the sex (male/female) of my own offspring (fetus). Investigating the cell-free fetal DNA circulating in a pregnant woman’s blood and performing prenatal STR and sex genotyping by PCR requires 3 key genomic DNA samples.

  • genomic DNA from the mother (any direct source)
  • gDNA from the alleged father (special Simon DNA of course)
  • cell-free circulating DNA from the fetus found in the mother’s plasma.
References

Clinical application of fetal sex determination using cell-free fetal DNA in pregnant carriers of X-linked genetic disorders. Kiyonori Miura et al. 2011 Journal of Human Genetics volume 56pages 296-299 (2011)

PCR Success Story #24

For: Myself
Experiment Dates: Oct.7th – Oct. 11th, 2018
Featured Product(s):  

Competitor Products for comparison: NEB M0491 , Thermo Phusion HS II, Qiagen Taq, NEB M0267.

Welcome to our lab mini16 miniPCR!

 

mini16 and mini8 small footprint

mini16 miniPCR

This PCR Success Story was entirely performed using the mini16 thermocycler from miniPCR & Amplyus

miniPCR logo

Human STRs (CODIS) and sex genotyping by PCR

 

The Combined DNA Index System, termed CODIS, blends forensic science and computer technology into a tool for linking violent crimes or simply identifying individuals based on their DNA. It enables federal, state, and local forensic laboratories to exchange and compare DNA profiles electronically, thereby linking DNA found on crime scenes to known offenders. Using the National DNA Index System of CODIS, the National Missing Persons DNA Database also helps identify missing and unidentified individuals.

The FBI Laboratory’s CODIS began as a pilot software project in 1990, serving 14 state and local laboratories. The DNA Identification Act of 1994 formalized the FBI’s authority to establish a National DNA Index System (NDIS) for law enforcement purposes. Today, over 190 public law enforcement laboratories participate in NDIS across the United States. Internationally, more than 90 law enforcement laboratories in over 50 countries use the CODIS software for their own database initiatives.

The DNA profile, also known as a DNA genotype, is stored in a database. For Forensic STR DNA analysis, the DNA profile consists of one or two alleles at the 20 CODIS Core Loci.

Ref: https://www.fbi.gov/services/laboratory/biometric-analysis/codis/

 

FBI CODIS Core STR Loci

The FBI’s published thirteen core loci for the Combined DNA Index System (CODIS) database. For more information, seeButler, J.M. (2006) Genetics and genomics of core STR loci used in human identity testing. J. Forensic Sci. 51(2): 253-265.

PAGE of 13 CODIS STR Loci

Polyacrylamide Gel Electrophoresis of 13 CODIS STR Loci and Amelogenin for the MBC1 (Panel A) and MBC2 (Panel B) Cell Lines. (Panel A): M: DNA molecular size marker. Lanes 1:Amelogenin (106 bp), FGA (185 bp, 193 bp), 2: D8S1179 (165 bp), 3: D16S539 (290 bp), 4: D18S51 (292 bp), 5: CSF1PO (304 bp, 324 bp), 6: TH01 (181 bp, 185 bp), TPOX (225 bp, 236 bp), and 7: VWA (145 bp, 150 bp), D21S11 (213 bp, 218 bp). (Panel B): M: DNA molecular size marker. Lanes 1: Amelogenin, FGA, 2: D8S1179, D7S820, 3: D3S1358, D16S539, 4: D13S317, D18S51, 5: D5S818, CSF1PO, 6: TH01, TPOX, and 7: VWA, D21S11. Kamalidehghan et al. (2012). Cancer Cell International. 12. 10.1186/1475-2867-12-43. Image under license CC BY 2.0

Customized DNA Primers used to amplify Amelogenin and 4 STR loci inspired from CODIS using standard and multiplex PCR.

Although the PAGE version of EasyTaq would have been available to us, our lab isn’t equipped for polyacrylamide gel electrophoresis (PAGE). Therefore, I chose 4 STR markers plus X (male) and Y (female) markers and redesigned the DNA oligonucleotide sequences in a manner that I could maximize the difference in PCR product sizes for each STR and analyze them using standard 3$ agarose gel electrophoresis. Despite this, it remains unlikely that small variations in single tandem repeats (i.e 3-9 bp) will be observable on an agarose gel.

Primer sequences are either identical or inspired from the following CODIS STR loci :

  • D14S608 (426bp)
  • D15S659 (284bp)
  • D7S3048 (234 bp)
  • D18S535 (a: 175bp; b: 201bp)

For AMEL X and Y loci, the DNA primers were not designed so that they would discriminate between chromosome X and Y based on PCR amplicon size. Instead, the oligonucleotides were designed to specically amplify either AMELX or AMELY based on their respective genomic DNA sequences.

F1.1 AMELXCCATTGTTTGCGTTAACAATGC (127 bp amplicon)

F1.2 AMELY : ATCACTGTTTGCATTAGCAGTCC (134 bp amplicon)

R1.1xy_AMEL :  ATCAGAGCTTAAACTGGGAAGCTG

* Nucleotides in bold represent mismatches between X and Y sequences in the Amelogenin gene.

All corresponding DNA files can be downloaded in Snapgene format here.

Example using custom CODIS STR primers

For validation, multiplex PCR was carried out using 2xFastPfu FLY AS231 and the mini8 miniPCR thermocycler.
Six microlitres of each PCR reaction was analyzed by electrophoresis in a 3% agarose gel.

Four different gDNAs were used as templates for custom STR analysis of D14S608 (green), D15S659 (red), D7S3048 (orange), D18S535 (a: yellow in lanes 1-4, ~175bp; b: lanes 6-10, ~201bp) and AMELX (left-side, pink) or AMELY (right-side, blue).

Lanes 1 and 6 (Unkn) : unknown donor (PCR Success Story #8)

Lanes 2 and 7 (SR) : my own (I’m a male) unpurified gDNA (used previously here)

Lanes 3 and 8 (293) :  HEK 293 cell unpurified gDNA (used previously here)

Lanes 4 and 9 (HeLa) : HeLa cell unpurified gDNA (used previously here)

Lane 5 : 100 bp Plus II DNA Ladder.

Results

The analysis of my DNA (SR lanes) using two versions of the forward primer (a or b) indicate that I’m homozygous for the D18S53S marker, whereas other analyzed samples indicated hemizygous alleles for the same marker. Results also confirmed samples Unkn and SR to be males (blue arrow) whereas 293 and HeLa cells were negative for Ameloganin amplification from the Y chromosome and positive for Ameloganin located on the X chromosome. Importantly, the results show a different band STR pattern for each DNA tested.

 

C-i-v-i-C logo red

How to Purify Fetal Cell-Free DNA from the Mother’s Blood ?

The average proportion of fetal DNA that can be found in the mother’s plasma represents only 5% of all cell-free DNA. This fact led me to develop an extraction protocol for obtaining cell-free gDNA from a small amount of the mother’s blood.

Cell-free DNA can be obtained from the blood stream. In order to test for the presence of fetal cell-free DNA in a pregnant woman’ blood, it is crucial to eliminate as many host cells  such as lymphocytes and loose epithelial cells prior to DNA purification.

Protocol for cffDNA purification

  1.  Wear gloves at all times and clean a small needle and a person’s finger with 70% EtOH.
  2. Puncture the finger’s skin once using the needle.
  3. Collect the blood (5-20 ul) from the finger using sterile filtered tips and a P10 micropipette and put the blood in a clear and sterile 1.5 ml centrifuge tube. Freeze at -20°C or proceed immediately to centrifugation steps.
  4. Centrifuge at 3 000 g for 3 minutes. Then, collect the supernatant by pipetting with a filtered tip and put into a new 1.5 ml tube.
  5. Dilute the supernatant from step 4 to a volume of 200 ul using sterile PBS.
  6. Centrifuge at 6 000 g for 3 min, collect the supernatant and transfer to a new centrifuge tube. Discard the pellet (buffy coat) or proceed with DNA extraction for comparative analysis.
  7. Centrifuge the supernatant from step 6 at 9 000 g for 3 min, collect the supernatant (cell-free plasma) and transfer to a new centrifuge tube.
  8. Proceed to DNA extraction protocol using MagicPure® Viral DNA/RNA Kit.
  9. Elute DNA from the beads with 50 ul EB buffer and collect 45 ul and transfer to a new tube for storage.

Centrifugation is Key to Successful Purification of cffDNA

Fetal cell-free circulating DNA accounts for 3 to 7% of the total cell-free DNA purified from the pregnant woman’s plasma. In consequence, PCR analyses on our cfDNA will always be strongly contaminated by the amplification of the host’s genome. The amelogenin gene sequence if different in sequence composition wether it is amplified from chromosome X (both sexes) or Y (males only).

C-i-v-i-C logo blue

Genomic DNA Extraction from the Mother and the Father

If I wished to validate my homemade paternity test, I would have to compare the cell-free fetal DNA obtained previously to genomic DNA from the mother and father.

Mother’s DNA (sample Mbc)

My girlfriend’s buffy coat (pellet from 2nd centrifugation and recovered from the initial 18 ul whole blood) was extracted and purified using BloodZol. The nearly invisible DNA pellet was disolved in 40 ul Tris pH 8.0. The DNA sample concentration and quality were not measured due to low concentration.

As an alternative source of DNA, DNA was obtained from 10 ul of saliva, purified with following the BloodZol procedure or not purified using TransDirect Animal Tissue Buffers. 

Father’s DNA (sample Fsp)

I used the EasyPure FFPE Tissue Extraction Kit from TransGen Biotech to extract and purify gDNA from my own semen (I did this for the good of science!).

The unique DNA packaging of spermatozoa renders them more resistant to DNA isolation techniques normally used for somatic cells. This is believed to be occasionned by an extensive reorganization of chromatin structure where approximatively 90% of histones are replaced by protamines in humans.

The FFPE Kit was used in this specific case to extract DNA from sperm because of the combined use of Proteinase K, a chaotropic salt and guanidine hydrochloride, which can help digest or remove protamines from the DNA structure. The DNA was isolated from the cell pellet obtained from the centrifugation of 200 ul of sperm (frozen and thawed for 15 min) for 3 min at 6 000 g.

BloodZol™ - EE131

85.00$ – 292.00$ CAD

 

C-i-v-i-C logo blue

Validation of STR and sex genotyping analysis from plasma cell-free fetal DNA

 

STR and Sex genotyping from cffDNA using multiplex PCR

 


PCR Setup with FastPfu FLY

H2O : fill to 15 ul
5x buffer : 3 ul
dNTPs (2.5 mM): 1.2 ul (0.2 mM final)
Forward Xa, Xb, Ya or Yb primer mix (10 uM each): 0.3 ul (200 nM final each)
Reverse XY primer mix (10 uM each) : 0.3 ul (200 nM final)
gDNA (50-500 copies/ul) : 1-3 ul
FastPfu FLY (2.5 u/ul) : 0.3 ul


PCR Cycling with FastPfu FLY

Denaturation: 120s at 95 °C
35 x

Denaturation: 10s at 95 °C
Annealing: 20s at 57 °C
Extension: 10s at 68 °C

Final extension: 180s at 68 °C

Validation of quintuplex PCR sex genotyping and STR analysis of cell-free fetal DNA

Prenatal cffDNA STR and sex/gender genotyping by multiplex PCR

Validation of quintuplex PCR sex genotyping and STR analysis of cell-free fetal DNA extracted from less than a droplet of fresh blood of a 10-week old pregnant woman. Three percent agarose gel electrophoresis of PCR amplifications obtained from the DNA of Mbc (mother’s buffy coat), Fsp (father’ sperm, Ceff (childrenmother’s plasma, cell-free DNA) or 3 parts Mbs plus 1 part Fsp). Pink and blue arrows point at Mbs or Fsp STR D18S535 respectively, using primer F1.3a_D18S535 (mix Ya) or F1.3b_D18S535 (mix Yb). White arrows point at the AMEL Y allele bands.

PCR with chromosome-specific Amelogenin DNA primers

Prenatal cffDNA chromosome-specific Amelogenin analysis by multiplex PCR

Validation by quintuplex PCR of chromosome-specific Amelogenin DNA primers used for sex genotyping and STR analysis of cell-free fetal DNA extracted of a 10-week old pregnant woman. Three percent agarose gel electrophoresis of PCR amplification products (6 ul per lane) obtained using the DNA of Mbc (mother’s buffy coat), Fsp (father’ sperm or Ceff (children/mother’s plasma, cell-free DNA).
Pink and blue arrows point at Mbs or Fsp STR D18S535 respectively, using primer F1.3a_D18S535 (mix Xa and Ya) or F1.3b_D18S535 (mix Xb and Yb). White arrows point at the AMEL X allele bands and yellow arrows at AMEL Y.

C-i-v-i-C red logo

WAIT! WHAT?

Is the Fbc DNA sample from the mother contaminated with my own?

That last yellow arrow…

Is this faint Y-specific Amelogenin PCR amplification and detection due to something else?

C-i-v-i-C logo red

Comparison of STR and Sex Genotyping using different DNA Polymerases

STR and Sex genotyping by PCR using High-Fidelity DNA Polymerases

 


Common PCR Setup for HiFi DNA Polymerases

H2O : fill to 15 ul
5x buffer : 3 ul
dNTPs (2.5 mM): 1.2 ul (0.2 mM final)
Forward Xa, Xb, Ya or Yb primer mix (10 uM each): 0.3 ul (200 nM final each)
Reverse XY primer mix (10 uM each) : 0.3 ul (200 nM final)
gDNA (50-500 copies/ul) : 1-3 ul
DNA Polymerase : 0.3 ul for AP231 and AP221; 0.15 or Ph and Q5.


PCR Cycling for HiFi DNA Polymerases

Denaturation: 60s at 98 °C

35 x

Denaturation: 5s at 98 °C
Annealing: 20s at 59 °C
Extension: 10s at 72 °C

Final extension: 180s at 72 °C

Multiplex STR genotyping with High-Fidelity DNA Polymerases

Comparison of Prenatal cffDNA Genotyping analysis by multiplex PCR using different High-Fidelity DNA Polymerases

Three percent agarose gel electrophoresis of PCR amplification products (6 ul per lane) obtained using the DNA of Mbc (mother’s buffy coat), Fsp (father’ sperm or Ceff (children/mother’s plasma, cell-free DNA) and amplified with well-known high-fidelity DNA polymerases and using 400 nM of each primer in the final reaction. White arrows point at the correct and specific AMEL Y allele amplied from Fsp and Ccff. Yellow arrows point at problematic AMEL Y allele amplified from the mother’s DNA randomly (not constant accross experiments).

AMEL Y-specific genotyping by PCR using High-Fidelity DNA Polymerases

AMEL Y-specific genotyping by PCR using High-Fidelity DNA Polymerases

Three percent agarose gel electrophoresis of PCR amplification products (6 ul per lane) obtained using the DNA of Usa (DNA from an unrelated female saliva), Msa (DNA from mothers’s saliva) or Ssa (DNA from my own saliva; male) and amplified with four different high-fidelity DNA polymerases and using 400 nM of each primer in the final reaction volue. White arrows point at the correct and specific AMEL Y allele amplied from the male sample (Ssa). Yellow arrows point at the problematic AMEL Y allele amplified from the mother’s DNA at random (not constant accross experiments).

u

Where is the Y coming from ?

Could non-specific AMEL Y amplification from women’s blood be caused by innate properties of high-fidelity DNA polymerases ?

STR and Sex genotyping by PCR using 3'-5' exonuclease-deficient Taq DNA Polymerases

 


Common PCR Setup for Taq DNA Polymerases

H2O : fill to 15 ul
10x buffer : 1.5 ul
dNTPs (2.5 mM): 1.2 ul (0.2 mM final)
Forward Xa, Xb, Ya or Yb primer mix (10 uM each): 0.6 ul (400 nM final each)
Reverse XY primer mix (10 uM each) : 0.6 ul (400 nM final)
gDNA (50-500 copies/ul) : 1-3 ul
DNA Polymerase : 0.15 ul


PCR Cycling for Taq DNA Polymerases

Denaturation: 120s at 94 °C

35 x

Denaturation: 5s at 94 °C
Annealing: 20s at 57 °C
Extension: 5s at 72 °C

Final extension: 120s at 72 °C

AMEL Y-specific genotyping by PCR using Taq DNA Polymerases

Comparison of AMEL Y-specific genotyping by PCR using Taq DNA Polymerases

Three percent agarose gel electrophoresis of PCR amplification products (6 ul per lane) obtained using the DNA of Usa (DNA from an unrelated female saliva), Msa (DNA from mothers’s saliva) or Ssa (DNA from my own saliva; male) and amplified with four different Taq DNA polymerases and using 400 nM of each primer in the final reaction volue. White arrows point at the correct and specific AMEL Y allele amplied from the male sample (Ssa). As expected, the Y allele was not detected in any female samples.

cffDNA STR and sex genotyping by multiplex PCR with FastTaq AP101

Confirmation of fetus sex by multiplex PCR using FastTaq DNA Polymerase

Three percent agarose gel electrophoresis of PCR amplification products (6 ul per lane) obtained using the DNA of Mbc (mother’s buffy coat), Fsp (father’ sperm or Ceff (children/mother’s plasma, cell-free DNA) and amplified with FastTaq DNA polymerase and using 200 nM of each primer in the final reaction volue. White arrows point at the chromosome X-specific allele amplified from all samples. Yellow arrows point at the Y-specific Amelogenin allele successfully amplified from the father’s DNA and from the cell-free fetal DNA isolated from the mother’s plasma.
NTC : no template control.

r

Confirmed : it's a BOY !

Non-specific AMEL Y amplification from women’s DNA was caused by the 3′-5′ exonuclease activity of high-fidelity DNA polymerases.

Because both X and Y-specific amelogenin PCR reactions use the same reverse primer, the HiFi DNA polymerases generate a lot of ssDNA strands using the Rxy primer. Hence, increasing amounts of ssDNA amplified from the women’s X chromosome favored the binding of the AMEL Y forward primer thanks to high levels of ‘fidelity’ inherent to 3′-5′ exo activity. See the first section for AMEL X and Y sequence mismatches.

Genuine Taq DNA Polymerases are devoid of 3′-5′ exonuclease activity. Hence, they are more suitable for genotyping in general because they amplify from primer-specific DNA sequences and mismatches at the 3′ end of DNA primers cannot be chewed back!

Want your PCRs to be easy ?

Put us in charge of optimizing PCR conditions for you. It’s FREE !

Get your own miniPCR at home or in your lab!

 

mini16 and mini8 small footprint

mini16 miniPCR: 1 290$ CAD

Comes fully equipped and ready-to-PCR!

Free Shipping to Canada only