TransNGS® DNA Library Prep Kit for Illumina® – KP201
This NGS DNA Library Prep Kit for Illumina® contains buffers and enzymes to generate next-generation sequencing libraries for Illumina® SE or PE sequencing platform from 1 ng to 1 μg fragmented double-stranded DNA. This kit is suitable for fragmented genomic DNA, PCR amplification products, ChIP DNA and FFPE DNA.
The TransNGS® DNA Library Prep Kit for Illumina® is compatible with other TransNGS series products.
Features of the TransNGS DNA Library Prep Kit for Illumina®
- Rapid and efficient : User-friendly, fast library prep with minimal hands-on time
- Low input DNA requirement : high-diversity and high-quality NGS librairies from minimal amount of input DNA (1 ng to 1 ug is recommended).
Components included with the TransNGS DNA Library Prep Kit for Illumina®
Component | KP201-01 (6 rxns) | KP201-02 (24 rxns) | KP201-03 (96 rxns) |
End-repair and A-tailing Reaction Mix | 60 μl | 240 μl | 960 μl |
End-repair and A-tailing Enzyme Mix | 30 μl | 120 μl | 480 μl |
End-repair and A-tailing Enhancer | 18 μl | 72 μl | 288 μl |
TransNGS® Adapter for Illumina® (10 μM) | 30 μl | 120 μl | 480 μl |
Adapter Dilution Buffer | 300 μl | 1.2 ml | 5 ml |
Adapter-ligation Buffer | 180 μl | 720 μl | 4×720 μl |
Adapter-ligation Enzyme | 30 μl | 120 μl | 480 μl |
TransNGS® Library Amplification SuperMix (2×) | 150 μl | 600 μl | 4×600 μl |
Library Elution Buffer | 1 ml | 4 ml | 4×4 ml |
Nuclease-free Water | 1 ml | 1 ml | 5 ml |
DNA Input Recommendations for DNA Library Prep
The quality and quantity of the input DNA is critical for DNA Library Prep. DNA should be purified and then dissolved in ddH2O or 10 mM Tris-HCl (pH8.0) with the OD260/OD280 between 1.8~2.0. Fluorescent dye measurement (i.e Qubit or PicoGreen) is highly recommended to determine DNA concentration. Avoid using spectrophotometry for DNA quantification (i.e UV absorbance or Nanodrop).
Workflow of NGS DNA Library Preparation with KP201
Timeflow of NGS Library Construction using KP201
KP201 NGS Library Structure
Using TransNGS® Single Index Primers Kit for Illumina® Set 1-3 (KI201-KI221) :
5`-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-XXXXXXXX-AGATCGGA
AGAGCACACGTCTGAACTCCAGTCAC[i7]ATCTCGTATGCCGTCTTCTGCTTG-3`
i7: Index 1, 6 bases
-XXXXXXXX-: insert DNA
Using TransNGS® Dual Index Primers Kit for Illumina® (KI231) :
5`-AATGATACGGCGACCACCGAGATCTACAC[i5]ACACTCTTTCCCTACACGACGCTCTTCCGATCT-XXXXXXXX-AG
ATCGGAAGAGCACACGTCTGAACTCCAGTCAC[i7]ATCTCGTATGCCGTCTTCTGCTTG-3`
i5: Index 2, 8 bases
i7: Index 1, 8 bases
-XXXXXXXX-: insert DNA.
Recommendations for DNA input for NGS Library Prep using KP201
The recommended DNA input is from 1 ng to 1 μ. fragmented double-stranded DNA. Purified DNA should be dissolved in
Nuclease-free Water or 10 mM Tris-HCl (pH8.0) with OD260/OD280 between 1.8~2.0.
Reagents not included with the KP201 kit
- 80% ethanol (freshly prepared)
- DNA size selection beads (MagicPure Size Selection DNA Beads)
- Index Primer Kit : TransNGS® Single Index Primers Kit for Illumina® (KI201-KI221) or TransNGS® Dual Index Primers Kit for Illumina® (KI231).
Manual & Datasheet
KP201 – TransNGS DNA Library Prep Kit for Illumina®
Illumina® is a trademark of Illumina Inc.
Additional information
Format | 6 rx, 24 rx, 96 rx |
---|---|
Supplier |
Ask a question about TransNGS DNA Library Prep Kit for Illumina® (1 ng – 1 ug) – KP201
You must be logged in to post a review.
Reviews