Select Page

TransNGS DNA Library Prep Kit for Illumina® (1 ng – 1 ug) – KP201

$190.00$2,352.00 CAD

0 in stock (expect 7-14 days for delivery)

Clear

Cashback Reward : Earn up to 235$!


6th Anniversary Promotions

Day(s)

:

Hour(s)

:

Minute(s)

:

Second(s)

Ask a question about TransNGS DNA Library Prep Kit for Illumina® (1 ng – 1 ug) – KP201

TransNGS® DNA Library Prep Kit for Illumina® – KP201

This NGS DNA Library Prep Kit for Illumina® contains buffers and enzymes to generate next-generation sequencing libraries for Illumina® SE or PE sequencing platform from 1 ng to 1 μg fragmented double-stranded DNA. This kit is suitable for fragmented genomic DNA, PCR amplification products, ChIP DNA and FFPE DNA.

The TransNGS® DNA Library Prep Kit for Illumina® is compatible with other TransNGS series products.


Features of the TransNGS DNA Library Prep Kit for Illumina®

  • Rapid and efficient : User-friendly, fast library prep with minimal hands-on time
  • Low input DNA requirement : high-diversity and high-quality NGS librairies from minimal amount of input DNA (1 ng to 1 ug is recommended).

Components included with the TransNGS DNA Library Prep Kit for Illumina®

Component KP201-01 (6 rxns) KP201-02 (24 rxns) KP201-03 (96 rxns)
End-repair and A-tailing Reaction Mix 60 μl 240 μl 960 μl
End-repair and A-tailing Enzyme Mix 30 μl 120 μl 480 μl
End-repair and A-tailing Enhancer 18 μl 72 μl 288 μl
TransNGS® Adapter for Illumina® (10 μM) 30 μl 120 μl 480 μl
Adapter Dilution Buffer 300 μl 1.2 ml 5 ml
Adapter-ligation Buffer 180 μl 720 μl 4×720 μl
Adapter-ligation Enzyme 30 μl 120 μl 480 μl
TransNGS® Library Amplification SuperMix (2×) 150 μl 600 μl 4×600 μl
Library Elution Buffer 1 ml 4 ml 4×4 ml
Nuclease-free Water 1 ml 1 ml 5 ml

DNA Input Recommendations for DNA Library Prep

The quality and quantity of the input DNA is critical for DNA Library Prep. DNA should be purified and then dissolved in ddH2O or 10 mM Tris-HCl (pH8.0) with the OD260/OD280 between 1.8~2.0. Fluorescent dye measurement (i.e Qubit or PicoGreen) is highly recommended to determine DNA concentration. Avoid using spectrophotometry for DNA quantification (i.e UV absorbance or Nanodrop).


Workflow of NGS DNA Library Preparation with KP201

KP201 Library Workflow

Schematic diagram of library construction
(i5 position with dotted line indicates some libraries do not have this Index.)


Timeflow of NGS Library Construction using KP201

KP201 Library Prep Time Flow

KP201 Library Prep Time Flow


KP201 NGS Library Structure

Using TransNGS® Single Index Primers Kit for Illumina® Set 1-3 (KI201-KI221) :
5`-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-XXXXXXXX-AGATCGGA
AGAGCACACGTCTGAACTCCAGTCAC[i7]ATCTCGTATGCCGTCTTCTGCTTG-3`

i7: Index 1, 6 bases
-XXXXXXXX-: insert DNA

Using TransNGS® Dual Index Primers Kit for Illumina® (KI231) :
5`-AATGATACGGCGACCACCGAGATCTACAC[i5]ACACTCTTTCCCTACACGACGCTCTTCCGATCT-XXXXXXXX-AG
ATCGGAAGAGCACACGTCTGAACTCCAGTCAC[i7]ATCTCGTATGCCGTCTTCTGCTTG-3`

i5: Index 2, 8 bases
i7: Index 1, 8 bases
-XXXXXXXX-: insert DNA.


Recommendations for DNA input for NGS Library Prep using KP201 

The recommended DNA input is from 1 ng to 1 μ. fragmented double-stranded DNA. Purified DNA should be dissolved in
Nuclease-free Water or 10 mM Tris-HCl (pH8.0) with OD260/OD280 between 1.8~2.0.


Reagents not included with the KP201 kit

  • 80% ethanol (freshly prepared)
  • DNA size selection beads (MagicPure Size Selection DNA Beads)
  • Index Primer Kit : TransNGS® Single Index Primers Kit for Illumina® (KI201-KI221) or TransNGS® Dual Index Primers Kit for Illumina® (KI231).

Manual & Datasheet

KP201 – TransNGS DNA Library Prep Kit for Illumina®


Illumina® is a trademark of Illumina Inc.

Additional information

Format

6 rx, 24 rx, 96 rx

Supplier

Reviews for TransNGS DNA Library Prep Kit for Illumina® (1 ng – 1 ug) – KP201

Reviews

Be the first to review “TransNGS DNA Library Prep Kit for Illumina® (1 ng – 1 ug) – KP201”