Select Page

TransNGS DNA Library Prep Kit for Illumina® (1 ng – 1 ug) – KP201

211.00$2,613.00$ CAD

0 in stock (expect 7-14 days for delivery)

Clear

Cashback Reward : Earn up to 261$!


TransNGS® DNA Library Prep Kit for Illumina® – KP201

This NGS DNA Library Prep Kit for Illumina® contains buffers and enzymes to generate next-generation sequencing libraries for Illumina® SE or PE sequencing platform from 1 ng to 1 μg fragmented double-stranded DNA. This kit is suitable for fragmented genomic DNA, PCR amplification products, ChIP DNA and FFPE DNA.

The TransNGS® DNA Library Prep Kit for Illumina® is compatible with other TransNGS series products.


Features of the TransNGS DNA Library Prep Kit for Illumina®

  • Rapid and efficient : User-friendly, fast library prep with minimal hands-on time
  • Low input DNA requirement : high-diversity and high-quality NGS librairies from minimal amount of input DNA (1 ng to 1 ug is recommended).

Components included with the TransNGS DNA Library Prep Kit for Illumina®

ComponentKP201-01 (6 rxns)KP201-02 (24 rxns)KP201-03 (96 rxns)
End-repair and A-tailing Reaction Mix60 μl240 μl960 μl
End-repair and A-tailing Enzyme Mix30 μl120 μl480 μl
End-repair and A-tailing Enhancer18 μl72 μl288 μl
TransNGS® Adapter for Illumina® (10 μM)30 μl120 μl480 μl
Adapter Dilution Buffer300 μl1.2 ml5 ml
Adapter-ligation Buffer180 μl720 μl4×720 μl
Adapter-ligation Enzyme30 μl120 μl480 μl
TransNGS® Library Amplification SuperMix (2×)150 μl600 μl4×600 μl
Library Elution Buffer1 ml4 ml4×4 ml
Nuclease-free Water1 ml1 ml5 ml

DNA Input Recommendations for DNA Library Prep

The quality and quantity of the input DNA is critical for DNA Library Prep. DNA should be purified and then dissolved in ddH2O or 10 mM Tris-HCl (pH8.0) with the OD260/OD280 between 1.8~2.0. Fluorescent dye measurement (i.e Qubit or PicoGreen) is highly recommended to determine DNA concentration. Avoid using spectrophotometry for DNA quantification (i.e UV absorbance or Nanodrop).


Workflow of NGS DNA Library Preparation with KP201

KP201 Library Workflow

Schematic diagram of library construction
(i5 position with dotted line indicates some libraries do not have this Index.)


Timeflow of NGS Library Construction using KP201

KP201 Library Prep Time Flow

KP201 Library Prep Time Flow


KP201 NGS Library Structure

Using TransNGS® Single Index Primers Kit for Illumina® Set 1-3 (KI201-KI221) :
5`-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-XXXXXXXX-AGATCGGA
AGAGCACACGTCTGAACTCCAGTCAC[i7]ATCTCGTATGCCGTCTTCTGCTTG-3`

i7: Index 1, 6 bases
-XXXXXXXX-: insert DNA

Using TransNGS® Dual Index Primers Kit for Illumina® (KI231) :
5`-AATGATACGGCGACCACCGAGATCTACAC[i5]ACACTCTTTCCCTACACGACGCTCTTCCGATCT-XXXXXXXX-AG
ATCGGAAGAGCACACGTCTGAACTCCAGTCAC[i7]ATCTCGTATGCCGTCTTCTGCTTG-3`

i5: Index 2, 8 bases
i7: Index 1, 8 bases
-XXXXXXXX-: insert DNA.


Recommendations for DNA input for NGS Library Prep using KP201 

The recommended DNA input is from 1 ng to 1 μ. fragmented double-stranded DNA. Purified DNA should be dissolved in
Nuclease-free Water or 10 mM Tris-HCl (pH8.0) with OD260/OD280 between 1.8~2.0.


Reagents not included with the KP201 kit

  • 80% ethanol (freshly prepared)
  • DNA size selection beads (MagicPure Size Selection DNA Beads)
  • Index Primer Kit : TransNGS® Single Index Primers Kit for Illumina® (KI201-KI221) or TransNGS® Dual Index Primers Kit for Illumina® (KI231).

Manual & Datasheet

KP201 – TransNGS DNA Library Prep Kit for Illumina®


Illumina® is a trademark of Illumina Inc.

Additional information

Format

6 rx, 24 rx, 96 rx

Supplier

Ask a question about TransNGS DNA Library Prep Kit for Illumina® (1 ng – 1 ug) – KP201

Reviews for TransNGS DNA Library Prep Kit for Illumina® (1 ng – 1 ug) – KP201

Reviews

    Be the first to review “TransNGS DNA Library Prep Kit for Illumina® (1 ng – 1 ug) – KP201”

    Your email address will not be published. Required fields are marked *