Select Page

CMV Forward Primer (100 µM) – CB-CMVF-01

6.00$ CAD

Clear
SKU: GJ501-01 Category: Tags: , Brand:

CMV Forward Primer (100 µM)

CMV Forward primer is often used for DNA sequencing.

Provided F-CMV (CMV Forward primer)

5′- AAATGGGCGGTAGGCGTG -3′

One hundred microliters (50 ul) of our CMV Forward Primer (100 µM) in ddH2O.

Note

The generic CMV forward primer sequence is often CGCAAATGGGCGGTAGGCGTG, as used by the sequencing platform used by Civic Bioscience.

Additional information

Format

50 ul

Supplier

Ask a question about CMV Forward Primer (100 µM) – CB-CMVF-01

Reviews for CMV Forward Primer (100 µM) – CB-CMVF-01

Reviews

Be the first to review “CMV Forward Primer (100 µM) – CB-CMVF-01”

Votre adresse e-mail ne sera pas publiée. Les champs obligatoires sont indiqués avec *