Select Page

Amplification of a 79% GC-rich fragment of human ARX (Aristaless-Related Homeobox) exon 2 containing 2 polyalanine tracts

FastPfuFastPfu FLY

Introduction

ARX is expressed in a wide variety of tissues including the brain, heart, skeletal muscle, testis, intestine, and pancreas [12]. The human ARX gene has five exons that together encode a number of protein domains of the transcription factor. These include a series of poly-alanine repeats whose expansion is associated with multiple seizure phenotypes and Partington syndrome in humans and mice, as well as reduced α-cell specification and increased α-cell apoptosis [3, 4]. Humans with X-linked lissencephaly with ambiguous genitalia (XLAG, OMIM # 300215) represent some of the most severe clinical effects of null mutations in ARX through functional loss of the DNA binding PRD-like homeodomain [3].

Alanine tracts are coded by imperfect trinucleotide repeats (GCN), among which GCG is significantly over-represented in the polyalanine coding sequence (5). It is stable during both meiosis and mitosis (6). However, polymorphisms in length are frequent involving more than 30% of tracts longer than seven alanines and correlating with the length of both the overall tract and the number of a single codon in a row (5).

GC-rich PCR amplification is known to be challenging. Detecting duplications or polyalanine extensions (GCG repeats) by PCR remains a challenge because of GC content and because of the repeated nucleotides. In 2008, Mammedov et al. established a theoretical model for successful amplification of a section of human ARX exon 2 using KOD Hotstart DNA Polymerase. We found that their results, although very interesting in the model they have established, could be ameliorated. Therefore, we assessed the capability of two of Transgen Biotech’s high-fidelity DNA polymerases to amplify the exact same segment using the same DNA primers used by the authors.

human ARK locus with primers for 79$ GC PCR amplification. This segment contains 2 out of the 3 polyadenine tracts of exon 2.

Fig.1 Human ARX complete locus with primers used to amplify a 79% GC-rich segment containing 2 out of the 3 polyalanine tracts of exon 2.

human ARX PCR amplification of a 79% GC-rich band using PCR stimulant.

Fig.2 Successful amplification of human ARX 79% GC-rich 658bp segment using FastPFu and FastPfu FLY with different amounts of PCR stimulant and using HeLa cell genomic DNA as template.

Results and Discussion

Our results (Fig.2) demonstrate clearly that by using PCR stimulant and lower extension temperatures, both FastPfu and FastPfu FLY were able to amplify specifically a 658bp with zero background noise or smearing. In contrast, using KOD hotstart, Mammedov et al. always contained some level of non-specific amplification and low yield in their PCR reactions. Thereby, we believe that any researcher or clinician investigating polyalanine tract extensions of human ARX in disease AND also requiring very high-fidelity in PCR amplification should use either FastPfu or FastPfu FLY. Indeed, KOD possesses only 6-fold better fidelity than Taq whereas FastPfu and FastPfu FLY possess 54-fold or 108-fold better fidelity respectively.

Fig.3A PCR amplification of MC1R from TransDirect SR and MA saliva lysates using FastPfu and FastPfu FLY.

Fig.3A PCR amplification of MC1R from TransDirect SR and MA saliva lysates using FastPfu and FastPfu FLY.

Fig.3B. PCR amplification of human ARX 79% GC-rich fragment containing 2 polyalanine tracts from TransDirect SR and MA saliva lysates using FastPfu and FastPfu FLY.

Fig.3B PCR amplification of human ARX 79% GC-rich segment using FastPFu and FastPfu FLY with 9ul PCR stimulant per 20 ul PCR reaction using TransDirect SR and MA lysates as templates.

We’ve previously shown elsewhere the efficiency of the TransDirect Animal PCR kit and we’ve also demonstrated that FastPfu and FastPfu FLY could successfully amplify both MC1R and MC2R from the SR and MA lysates. Figure 3A shows successful amplification of MC1R by FastPfu and FastPfu FLY from both SR and MA lysates (contains DNA polymerase inhibitors; unpurified gDNA). We’ve then used optimal PCR stimulant concentrations used in Figure 2 to try to amplify the same ARX fragment from difficult SR and MA gDNA samples. Figure 3B shows that, using 9ul PCR stimulant per 20 ul PCR reaction FastPfu FLY was able to amplify the intended ARX band from our most difficult gDNA sample. Maybe the nature of the gDNA sample prevented FastPfu FLY from amplifying the same ARX band, but maybe it simply modified the concentration of PCR stimulant needed to achieve successful PCR amplification of the 79% GC-rich amplicon from the TransDirect saliva lysate – more tests would be required to confirm these hypotheses.

Interested in reading more product performance and comparison tests? Visit these posts below.

Materials and Methods

20ul PCR reaction setup

  • H2O: up to 20 ul
  • 5x buffer: 4 ul (1x final concentration)
  • 2.5 mM dNTPs: 1.6 ul (200 uM)
  • Forward primer: 0.4 ul (200 nM)
  • Reverse primer: 0.4 ul (200 nM)
  • HeLA gDNA: 0.2 ul (20 ng)
  • 5x PCR stimulant: 0, 3, 6 or 9 ul (0, 0.75, 1.5, 2.25x final concentration)
  • Polymerase: 0.4 ul (equivalent to 2.5u /50ul)

Reaction were setup at room temperature using either TransStart® FastPfu or FastPfu FLY DNA Polymerases using respective buffers.

Forward primer sequence: CCAAGGCGTCGAAGTCTG

Reverse primer sequence: GCTCACTCAGTGTGGCAAAG

PCR cycling conditions:

Thermocycler : miniPCR

Initial denaturation: 60s at 98°C

35 cycles:

  • 15s at 98°C
  • 10s at 53°C
  • 45s at 68°C

Final extension: 120s at 68°C